Luqadda Nolosha (DNA) iyo Hab-qoraalka Hidde Sidayaasha (Genes)

L
TAXANAHA: Ibo Furka iyo Fahanka guud ee Aragtida Horumarka Noolayaasha (Evolution)
Ibo Furka iyo Fahanka guud ee Aragtida Horumarka Noolayaasha (Evolution) waa silisilad qormooyin taxane ah oo Aadan Cali kaga jawaabayo waydiimo la xiriira aragti cilmiyeedka Horumarka Noolayaasha (Evolution).
Eeg Qormooyinka Taxanahan
1. Taariikh kooban
2. Waa kuma Daarwiin
3. Luqadda Nolosha (DNA) iyo Habqoraalka Hidde Sidayaasha (Genes)

 

Luqadda Nolosha (DNA) iyo Hab-qoraalka Hidde Sidayaasha (Genes)

Dabaqyada DNA-ga ee ilaa hadda la diiwaan geliyay waxay kor u dhaafayaan 40 kun oo buug dhame (Volume), buugtaas midkiibba waxuu ka kooban yahay wax ku dhow hal malyan oo xaraf. Diiwaangelinta xarfaha DNA-ga noolaha qaar sida Aadanaha waxaa loo baahan yahay wax ka badan 3 kun oo buug midkiibana hal Milyan oo xaraf ka kooban yahay. Halka diiwangelinta DNA ga bakteeriyada aad uga baahan doonto Saddex ilaa afar buug, Midkasta ood furto oo Diiwaanadaas ka mida waxaad ugu tegi doontaa Xarafahan (ACGGGTATGGGCTACCAAGGGCTACCA).
oo isdaba yaal boqolaal bog.
Sidoo kale haddaad awoodi lahayd inaad furto unug kamida unugyada noole kaste waxaad ku arki lahayd wax u qaab eeg qoraalkan sare.

Su’aasha is waydiinta mudani kolkaa waxay tahay sidee Qoraalladan aan quruxda badnayni u qaabayn karaan qaab dhismeedka noole dhamaystiran?!
Sidee baynu se u akhriyi karnaa luqadda nolosha ama DNA-ga.
Si aan u fahanno luqadda nolosha waa inaan akhrinnaa qaab qoraalka DNA-ga , kolkaas baynuna samayn karnaa is bar-bardhigga noolayaasha ogaanna karnaa sida ay isu kala abnaq xigaan. Luqaddani maaha mid kakan xarfaheedu way kooban yihiin, naxweheeduna ma adka, faa’iidada barashada luqaddanina waa inaad awood u yeelan doonto inaad aragto si fududna u fahanto Aragtida Horumarka Noolayaasha.
Aan Bilawnee bal ka bogo,*

QORMO LA XIRIIRTA:  Maxay ku dhacday in nin kasta oo wahaabi weyn ahi uu lacag badan haysto?

(Proteins) ama Booratiinadu waa (Molecules) ama shayga qabta shaqada ugu badan ee noole kasta, kasoo billaw inuu Oxygen-ta qaado ilaa inuu sameeyo unugyada cusub ee jidhka (unug kasta oo jidhkaaga ka mida sida unugyada lafaha, murqaha,carjawda, jidhka iyo weliba Timaha iyo Cidiyuhu wuxuu ka samaysan yahiin Booratiin),
Sidaa darteed (DNA)’ga noole walbaa waxuu sidaa Awaamiir gooniya ama (Codes) samayn doona Booratinada noolahaas ka dhigi doona mid kuwa kale ka duwan.

DNA’gu waxuu ka samaysan yahay laba diillimood oo isku duuban, diillin waliba waxay leedahay afar “gacmood” (bases) oo kala duwan, Gacmaha DNA’ga waxaa loo soo qaataa afarta xaraf ee (A C G T), Labada diillimood ee DNA-ga waxaa isu haya dabar kiimikeed aad u adag, (A)’du kol walba waxay ku lammaanataa (T) da, (C)’duna waxay ku lammaanaataa (G) da. Xaqiiqada layaabka lihi waxay tahay in dhammaan kala duwanaashaha noloshu kasoo jeedo kala bed-bedelka habdhaca (Permutations)ka afartaa xaraf.

Haddaba sidee booratiinnada loo sameeyaa, sidee bay se ku gartaan shaqaddooda?!
Booratiinnada laftoodu waxay ka samaysan yihiin (Amino acids), Amino acid kastaa waxuu ka koobanyahay isku darka sadex xaraf sida (ACT ama GAA) oo kamida diillinta DNA’ga, astaamaha kiimikeed ama falgal ee (Amino acid) kaasi kolka loo habeeyo habka silsilida ku dhowaad 400 oo Amino acid, waxay go’aamiyaan shaqada Booratiinkaas.

Gobol kasta oo DNA-ga kamid ah kaas oo sameeya Booratiin gaar ah waxaa loo yaqaan Gene ama Hidde Side.

Xidhiidhka ka dhexeeya DNA-ga iyo Booratiinada waa la yaqaan, waayo saynis-yahanadu waxay wax ka badan afartan sano kahor jabsheen (code) ka ama habdhaca iyo qaab qoraalka Hidde sidayaasha. Akhrinta DNA-ga iyo qaabka ay Booratiinada u samaysaan waa laba tallaabo, tallaabada hore halduub oo kamida labadda duub ee DNA-ga waxa lagu dhejaa duubka loo yaqaan massenger RNA ama (mRNA), duubkan shaqadiisu waxay tahay koobiyaynta iyo kala furidda labada duub ee DNA’ga, kadibna duubkii RNA-ga ahaa waxaa loo turjumaa Amino acids, kuwaas oo iyana ku samayn doona Booratiinka unugga gudahiisa. Haddaba Hab-qoraalka hidda sidaha waxa laga soo akhriyaa mRNA’da ka hor intaanay Amino acid u rogin, kolkiibana waxa la akhriyaa sadex xaraf oo u dhigma hal Amino acid.

Waxa jira Lixdan iyo Afar (64) saddex dhac sida (ACT ama GGG) oo ay isu raaci karaan xarfaha (ACGT), laakiin waxuun bay samayn karaan 20 amino acid, saddex kamida saddex dhacyadaasi waxba ma sameeyaan waxaanay tusiyaan uun bar-dhammaadka turjumaadda mRNA-da iyo samayska Booratiin gooni ah (waana sida joogsiga hormo hadalkani ku dhamaado).

QORMO LA XIRIIRTA:  Johoraddii Geeska iyo Jinkii Reer Axmar

Qaab-qoraalkani marka laga reebo meelo yar yar waa mid ay ka simanyihiin noolayaasha oo dhami, waana sababta bakteeriyada loogu isticmaali karo in laga sameeyo qaar kamida Booratiinada dadka sida (Insulin) taas oo daawo ahaan ay u qaataan dadka macaanka qaba, jidhkooduna aanu awoodin inuu sameeyo Insulin. Sidaa darteed haddaan hayno isdaba-yaal kamida labda diillimood ee DNA-ga waxaan garan karnaa Boortiinada ay samayn doonto.

Qaybo badan oo DNA-ga kamida waxba uma taagna waana (nonecoding), Tanina waxay ahayd caqabaddii ugu horraysay ee ay Saynis-yahannadu la kulmeen, waana kala saaridda qaybaha xogta booratiin samaynta sida ee Diillinta DNA-ga iyo qaybaha aan xogta sidin. Nasiib wanaag hadda shaqadaa waxa qabta Kambayuutaro waaweyn kuwaas oo isticmaalaya (Algorithms) kala sooci kara qaybaha Diillinta DNA-ga ka kooban ee xogta sida iyo qaybaha kale, waana ta inoo sahashay inaan akhrino Hidda-sidayaasha nooleyaal badan.

Dhererka Hiddaha sidaha dhex-dhexaadka ahi waa 1200 oo beer. Noolayaasha qaarkood gaar ahaan kuwa il-maqabatayga ah sida bakteeriyada Hidda sidayaashoodu waa kuwo aad isugu dhow-dhow kumana badna (nonecoding DNA), halka noolayaasha qaab dhismeed koodu kakan yahay sida Aaddanaha ay aadka ugu badan yihiin gobolada DNA-ga aan waxba u taagnayn ama (nonecoding DNA), Hidda sidayaashuna waa kuwo kooban oo badwayntaa ku filiqsan.

Qaybtan iyo Qaybta xigta oo ku saabsan (Mutations) ka waxay soo dhoweyn doonaan fahanka qaar kamida tiirarka aragtida sida Evolutionka, Descent with modification iyo Gradualism. Sidaad darteed baana usoo horumariyay.

JOIN OUR NEWSLETTER
Fadlan geli Email-kaaga oo rukumo si laguu ogaysiiyo qormooyinka cusub.
We hate spam. Your email address will not be sold or shared with anyone else.

Aragtidaada kudar qormadan

avatar

My Bookmarks

Follow Us

[likebtn theme="padded" counter_type="subtract_dislikes" tooltip_enabled="0" white_label="1" newline="1" popup_disabled="1"][cbxwpbookmarkbtn]

Send this to a friend